View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14345_high_3 (Length: 313)
Name: NF14345_high_3
Description: NF14345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14345_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 7905307 - 7905601
Alignment:
| Q |
1 |
gccgtataaggacttgagcagcttacaaacctgcccaggcctaggaggagaaacaccttgaggagggtgcatgtagacatcctcttgaagatcaccgtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905307 |
gccgtataaggacttgagcagcttacaaacctgcccaggcctaggaggagaaacaccttgaggagggtgcatgtagacatcctcttgaagatcaccgtgc |
7905406 |
T |
 |
| Q |
101 |
aagaaggcgttgttaacgtctaattggtggagatgccatcgttttatagaagcaacaacaagcaacaatcaaacagttgacagtttttccaccagagaga |
200 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7905407 |
aagaaggtgttgttagcgtctaattggtggagatgccatcgtttaatagaagtaacagcaagcaacaatcaaacaattgacagttttgccaccagagaga |
7905506 |
T |
 |
| Q |
201 |
gtgcnnnnnnnnnnnntccacgccttcgatttgattgtaacccttggctacaagacgtgctctatagcgctcaatagaaccattggcatgccgttta |
297 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7905507 |
gtg--taaaaaaaaaatccacgccttcgatttgattgtaacccttggctacaagacatgcattatagcgctcaatagaaccattggcataccgttta |
7905601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University