View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14345_high_4 (Length: 263)
Name: NF14345_high_4
Description: NF14345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14345_high_4 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 114 - 263
Target Start/End: Original strand, 51419967 - 51420116
Alignment:
| Q |
114 |
cccacataattggagtgagtcctatcatcacgctaaatactaccaattccagtcaaatagacaattgcaaaactggaatggtagttcataaaatagcata |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51419967 |
cccacataattggagtgagacctatcatcacgccaaatactaccaattccagtcaaatagacaattgcaaaactggaatggaagttcataaaatagcata |
51420066 |
T |
 |
| Q |
214 |
tccattattggctggaaaactacaaagttagcatgaatgatgtggcatat |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51420067 |
tccattattggctggaaaactacaaagttagcatgaatgatgtggcatat |
51420116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 48
Target Start/End: Original strand, 51419871 - 51419900
Alignment:
| Q |
19 |
cacaatatcaaatgtaaagctttatttttt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51419871 |
cacaatatcaaatgtaaagctttatttttt |
51419900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University