View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14346_high_1 (Length: 607)
Name: NF14346_high_1
Description: NF14346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14346_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 514; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 514; E-Value: 0
Query Start/End: Original strand, 18 - 592
Target Start/End: Complemental strand, 7905330 - 7904764
Alignment:
| Q |
18 |
aagctgctcaagtccttatacggcctcaaacatgccagccggcgttggtttgaaaagcttatttcactcctcctgaccattggttttgtgcaagcttcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905330 |
aagctgctcaagtccttatacggcctcaaacaagccagccggcgttggtttgaaaagcttatttcactcctcctgaccattggttttgtgcaagcttcag |
7905231 |
T |
 |
| Q |
118 |
ctgatcactcctttttaattcgtgcttctccaacttctttcacagctttattaatatacgtgaatgacattatattggctggtgactgccttgctgcttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905230 |
ctgatcactcctttttaattcgtgcttctccaacttctttcacagctttattaatatacgtgaatgacattatattggctggtgactgccttgctgcttt |
7905131 |
T |
 |
| Q |
218 |
tgctgagattaagcaattgcttgatcatcattttcgtatcaaagaccttggccagctcaagttctttcttggcttggaggttgctcattcctcaaaaggt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7905130 |
tgctgagattaagcaattgcttgatcatcattttcgtatcaaagacctaggctagctcaagttctttcttggcttggaggttgctcattcctcaaa---- |
7905035 |
T |
 |
| Q |
318 |
ttaaaggtatatccctctgtcaacgcaaatattgcctcgacttactttcagatgcaggcctaaccacttgtaaaccggttagtactcctcttgattatgc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7905034 |
----aggtatatccctctgtcaacgcaaatattgcctcgacttactttcagatgcaggcctaaccacttgtaaatcggttagtactcctcttgattatgc |
7904939 |
T |
 |
| Q |
418 |
ttgtcgtctccacattgatgatggacctccctttgatgatgttttggcttatcgccgtctcattggttgcttgttatacttgactacgactcgccctgac |
517 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7904938 |
ttgtcttcttcacattgatgatggacctccctttgatgatgttttggcttatcgctgtctcattggttgcttgttatacttgactacgactcgccctgac |
7904839 |
T |
 |
| Q |
518 |
atcagttttgccacacagcaactgagtcagttcatggccaagccatccgtaaaccatcatcgcgctgctctttgt |
592 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7904838 |
atcagttttgccacacagcaactgagtcagttcatggccaagccatccgtaaaccatcatcgcactgctctttgt |
7904764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University