View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14346_high_27 (Length: 261)
Name: NF14346_high_27
Description: NF14346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14346_high_27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 141 - 261
Target Start/End: Complemental strand, 224254 - 224134
Alignment:
| Q |
141 |
taaatataaataccacataataatgacttctataaaatgaatgttataaggaaaaaaggcctgnnnnnnntgtgatactatattttgttcaagtcaaaaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
224254 |
taaatataaataccacataataatgacttctataaaatgaatgttataaggaaaaaaggcctgaaaaaaatgtgatactatattttgttcaagtcaaaaa |
224155 |
T |
 |
| Q |
241 |
agaattaccttatccatttat |
261 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
224154 |
agaattaccttatccatttat |
224134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University