View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14346_high_31 (Length: 254)
Name: NF14346_high_31
Description: NF14346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14346_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 6 - 182
Target Start/End: Complemental strand, 19359671 - 19359495
Alignment:
| Q |
6 |
aagatttggtgtggaaactcatacagtgaaaattggcatagatcatacttgagtgatagatcatagtaatcaaattaggaattagtcagagtttttaatc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19359671 |
aagatttggtgtggaaactcatacagtgaaaattggcatagatcatacttgagtgatagatcatagtaatcaaattaggaattagtcagagtttttaatc |
19359572 |
T |
 |
| Q |
106 |
atcttaaataaatgaactgcttcagcttttatgtctacgaagttattctactcgtaccaacaatgaaacttaatgat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19359571 |
atcttaaataaatgaactgcttcagcttttatgtctacgaagttattctactcgtaccagcaatgaaacttaatgat |
19359495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 203 - 244
Target Start/End: Complemental strand, 19359474 - 19359433
Alignment:
| Q |
203 |
ttacattagttctttaaggtgaccagatcatagtattttcat |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19359474 |
ttacattagttctttaaggtgaccggatcatagtattttcat |
19359433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University