View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14346_high_37 (Length: 229)
Name: NF14346_high_37
Description: NF14346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14346_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 128314 - 128136
Alignment:
| Q |
13 |
aagaatataatagcacaaaatctgctagtatttggacagaatgaaccaaatttgcctagtatttggctttttaatatgacaacctttcacaaattcaaaa |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
128314 |
aagaaaataatagcacaaaatctgctagtatttggacagaatgaaccaaatttgcctagtatttggctttttaatatgacaacctttcacaaattcaaaa |
128215 |
T |
 |
| Q |
113 |
atgggtaacgtaaataacatttatgagaacgagttcattatactacttttattcccgagtacacctgaatagttttttg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
128214 |
atgggtaacgtaaataacatttatgagaacgagttcattatactacttttattcccgtgtacacctgaatagttttttg |
128136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University