View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14346_high_39 (Length: 202)
Name: NF14346_high_39
Description: NF14346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14346_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 11558335 - 11558531
Alignment:
| Q |
1 |
caaaattttctcgatgtgtctctggtggtgactttggtcctcaaatatgtttttggttagctcgtttgttctctgaatgtgtgtttcatttgttagtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11558335 |
caaaattttctcgatgtgtctctggtagtgactttggtcctcaaatatgtttttggttagctcgtttgttctctgaatgtgtgtttcatttgttagtaat |
11558434 |
T |
 |
| Q |
101 |
gtcgaacaaattactagcagaagatacgctaaaagatgcttctataattttgatacatttagggattatatcgacactcaccgacatattcttggac |
197 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11558435 |
gtcgaacaaattactagcaaaagatacgctaaaagatgcttctataattttgatacatttagggattatatcgacactcaccgacatatttttggac |
11558531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 14 - 91
Target Start/End: Original strand, 11544930 - 11545013
Alignment:
| Q |
14 |
atgtgtctctggtggtgacttt------ggtcctcaaatatgtttttggttagctcgtttgttctctgaatgtgtgtttcattt |
91 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| | |||| |||| |||||||||||||||||| |
|
|
| T |
11544930 |
atgtgtctctggtggtgacttttggtttggtcctcaaatatgtttttggttaggtagtttcttctttgaatgtgtgtttcattt |
11545013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 145 - 177
Target Start/End: Original strand, 8379183 - 8379215
Alignment:
| Q |
145 |
taattttgatacatttagggattatatcgacac |
177 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
8379183 |
taattttgatagatttagggattatatcgacac |
8379215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University