View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14346_low_24 (Length: 317)
Name: NF14346_low_24
Description: NF14346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14346_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 299
Target Start/End: Complemental strand, 27016318 - 27016033
Alignment:
| Q |
14 |
caaaggcaaggagacttggggtttgtacaccggtattatatgctgttgatcctgtgttgcacacattaacatttgaattcgttgacggaccttcggtcaa |
113 |
Q |
| |
|
|||| |||||| |||| || |||||||| || || | |||||||| |||||||| | ||||| |||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
27016318 |
caaaagcaaggcgactcggtgtttgtactcctgtgctgtatgctgtggatcctgtatcacacactttaacatttgaatttgttgaaggaccttcagtcaa |
27016219 |
T |
 |
| Q |
114 |
agatgtatttcttgaattcggatcatgcggtgtcaatgaagagcgcctgggaaagattgcatcccaaattggtgatgtaattgcgaagttacatgatggt |
213 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27016218 |
agatgtatttctcgaattcggatcatgtggtgtcaatgaagagcgcttgggaaagattgcatcccaaattggtgatgtaattgcgaagttacatgatggt |
27016119 |
T |
 |
| Q |
214 |
ggtcttgttcatggcgatttaacaacatcaaacatgttactaaagaatgatactgatcagttggtgcgttcattcatctcttaggt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
27016118 |
ggtcttgttcatggcgatttaacaacatcaaacatgttactaaagaatgatactgatcagttggtgagttcattcgtctcttaggt |
27016033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University