View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14346_low_37 (Length: 240)
Name: NF14346_low_37
Description: NF14346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14346_low_37 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 223934 - 224155
Alignment:
| Q |
18 |
ttttaaggggttaattaagtctttgacataaaatacatgaattaatctcttgaaattttcatactatagacaaattagtctttaacttaatatatcagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
223934 |
ttttaaggggttaattaagtctttgacataaaatacttcaattaatctct-gaaattttcatactatagacaaattagtctttaacttaatatatcagag |
224032 |
T |
 |
| Q |
118 |
aaaataatttgtccccaatataaaaatgacatgattaatttgagtttannnnnnnngttaaggactgttttgacccacaagaattgaatctacattgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
224033 |
aaaataatttgtccccaatataaaaatgacatgattaatttgagtttattttttttgttaaggactgttttgacccacaagaattgaatctacattgaag |
224132 |
T |
 |
| Q |
218 |
aataaatggataaggtaattctt |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
224133 |
aataaatggataaggtaattctt |
224155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University