View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14346_low_40 (Length: 219)
Name: NF14346_low_40
Description: NF14346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14346_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 33 - 157
Target Start/End: Complemental strand, 13481055 - 13480931
Alignment:
| Q |
33 |
agtagcaaaattttgtgttgggtgaatcacatcttggacacttcatgttttgttccggtggttttgttgttgaggtagaagatgatgaagatgttttctt |
132 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13481055 |
agtagcagaattttgtgttgggtgagtcacatcttggacacttcatgttttgttctggtggttttgttgttgaggtagaagatgatgaagatgttttctt |
13480956 |
T |
|
| Q |
133 |
accaacagaaccttgctggttattg |
157 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
13480955 |
accaacagaaccttgctggttattg |
13480931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University