View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14347_low_3 (Length: 235)
Name: NF14347_low_3
Description: NF14347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14347_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 32 - 217
Target Start/End: Complemental strand, 34138259 - 34138074
Alignment:
| Q |
32 |
atttctgctcaatgttgtctcaaacaaaaatatttgattaattttgatgttatcatatcatatcttatttacgatattcaagcaattttaaattttttat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34138259 |
atttctgctcaatgttgtctcaaacaaaaatatttgattaattttgatgttatcatatcatatcttatttacgatattcaagcaattttaaattttttat |
34138160 |
T |
 |
| Q |
132 |
gctacccactttgttacgtcaagttcctctagtgattaacattgaaaccttctatgacactcctatagaagatgttgtttggatta |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
34138159 |
gctacccgctttgttacgtcaagttcctctagtgattaacattgaaaccttctatgacactcctattgaagatgctgtttggatta |
34138074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University