View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_high_109 (Length: 231)
Name: NF14349_high_109
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_high_109 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 38936440 - 38936629
Alignment:
| Q |
18 |
cgtatgataccaaaactactcatattatgccattttgatttttattacttttgtaaattgaaagaaaattttgttagtgaatagagaaaattgatattaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38936440 |
cgtatgataccaaaactactcatattatgccattttgatttttattaattttgtaaattgaaagaaaattttgttagtgaatagagaaaattgatattaa |
38936539 |
T |
 |
| Q |
118 |
tgtttaggaattctctttttgtttcttgaaggtatatatatgatatgagaaaattggagagttttcagtgtgcagtttctatacggattattat |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38936540 |
tgtttaggaattctctttttgttacttgaagg----tatatgatatgagaaaattggagagttttcagtgtgcagtttctatacggattattat |
38936629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University