View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_high_116 (Length: 219)
Name: NF14349_high_116
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_high_116 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 68 - 219
Target Start/End: Original strand, 21725211 - 21725361
Alignment:
| Q |
68 |
ttagtttccactacggtgggacaactactttgattactcaacataattcgactacaacaaaccaaaataagcacatgaatggctnnnnnnncatcaggga |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
21725211 |
ttagtttccactacggtgggacaactactttgattactcaacataattcgactacaacaaaccaaaataagcacaagaatggct-aaaaaacatcaggga |
21725309 |
T |
|
| Q |
168 |
aggaacaagtttgttacattaaactgatatgaaacatacaagttaatgagac |
219 |
Q |
| |
|
||||||| |||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
21725310 |
aggaacacgtttgttacattgaactgctatgaaacatacaagttaatgagac |
21725361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University