View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_high_117 (Length: 214)
Name: NF14349_high_117
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_high_117 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 6324003 - 6323818
Alignment:
| Q |
10 |
catgccaatctcgttttcagacaatgacttcacattgatcacaagaactaatgttcctcttcatacgcgaacattctctactggtccgcgttcttgaaga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6324003 |
catgccaatctcgttttcagacaatgacttcacattgatcacaagaactaatgttcctcttcatacgtgaacattctctactggtccgcgttcttgaaga |
6323904 |
T |
|
| Q |
110 |
tgggactgtcagagacaatgctgaaaccattagaagcatatctcaaggatgttatcggaaatggtgtaccagtgaaaggatatatt |
195 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6323903 |
tgggactgttagagacaatgctgaaaccattagaagcatatctcaagggtgttatcggaaatggtgtaccagtgaaaggatatatt |
6323818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 80 - 191
Target Start/End: Complemental strand, 6318052 - 6317941
Alignment:
| Q |
80 |
acattctctactggtccgcgttcttgaagatgggactgtcagagacaatgctgaaaccattagaagcatatctcaaggatgttatcggaaatggtgtacc |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| ||||||| ||||||| |||||| ||||||| || | | ||||| |||||||| |
|
|
| T |
6318052 |
acattctctactggtccgcattcttgaagatgggactttcagaatcaatgctcaaaccatgtcaagcatttctcaagtatacttttggaaaaggtgtacc |
6317953 |
T |
|
| Q |
180 |
agtgaaaggata |
191 |
Q |
| |
|
||| |||||||| |
|
|
| T |
6317952 |
agtcaaaggata |
6317941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 6310281 - 6310211
Alignment:
| Q |
75 |
cgcgaacattctctactggtccgcgttcttgaagatgggactgtcagagacaatgctgaaaccattagaag |
145 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||| |||| |||||||||||||||| |||| |
|
|
| T |
6310281 |
cgcgaacattctttactggtccgcattcttgaagatgggactggaagagtcaatgctgaaaccatttgaag |
6310211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University