View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_high_36 (Length: 421)
Name: NF14349_high_36
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_high_36 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 245 - 366
Target Start/End: Original strand, 33714973 - 33715095
Alignment:
| Q |
245 |
ttgtagatagtatatagagctatggctatgttacatgaaaaa-gttttcctttcatatcgttgagtttatagatggaaatgttaatttatctttttatct |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| | ||| |||||| || |||||| |||||||||| || |||||||||| ||||| || |
|
|
| T |
33714973 |
ttgtagatagtatatagagctatggctatgttacataaaaaaaggtttactttcaaattgttgagcttatagatggcaaggttaatttattgttttaact |
33715072 |
T |
 |
| Q |
344 |
gaaccattacagtgcagccatag |
366 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
33715073 |
gaaccattgcagtgcagccatag |
33715095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 330 - 399
Target Start/End: Complemental strand, 47021 - 46952
Alignment:
| Q |
330 |
ttatctttttatctgaaccattacagtgcagccatagaagaaacatatgttaggtaacttgtttagtgtg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
47021 |
ttatctttttatctgaaccattacagtgcagccatagaagaaacatatgttaggcagcttgtttagtgtg |
46952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 148 - 226
Target Start/End: Original strand, 43206799 - 43206878
Alignment:
| Q |
148 |
tttgtatatatagatgttgtattgaacctttccaattaatgaaacaatgag-attcattaatttctctcaatttataata |
226 |
Q |
| |
|
||||| |||||| |||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||| |
|
|
| T |
43206799 |
tttgtgtatatacatgttgtactgaacctttccaattaatgaaacaatgagtattcattcatttctctcaattcataata |
43206878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University