View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_high_42 (Length: 390)
Name: NF14349_high_42
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 163 - 372
Target Start/End: Complemental strand, 31924480 - 31924271
Alignment:
| Q |
163 |
aatttcaccaatcatttcctctcactacattctctcttttgctgctagaaaggagtaatatttgggtttgtatgtgagagaaaaatagaggttttaagac |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31924480 |
aatttcaccaatcatttcctctcactacattctctcttttgctgctagaaaggagtaatatttgggtttgtatgtgagagaaaaatagaggttttaagac |
31924381 |
T |
 |
| Q |
263 |
caatgaaataccattagaaagaaaatgagcacctcagaatacattattatcttcatcaattattcatcgctatcttactaatattaacccttggcagtcc |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31924380 |
caatgaaataccattagaaagaaaatgagcacctcagaatacattattatcttcatcaattattcatcgctatcttactaatattaacccttggcagtca |
31924281 |
T |
 |
| Q |
363 |
tattgacttg |
372 |
Q |
| |
|
|||||||||| |
|
|
| T |
31924280 |
tattgacttg |
31924271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 31924979 - 31924810
Alignment:
| Q |
1 |
aagattcattgaaaatgaacattgatgtcatctaactggattgaaacgttgatctagtacgctgacagtgtaaatgattatcaccatcaccaccttcacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31924979 |
aagattcattgaaaatgaacattgatgtcatctaactggattgaaacgttgatctagtatgctgacaatgtaaatgattatcaccatcaccaccttcacg |
31924880 |
T |
 |
| Q |
101 |
ccatctaaatcatcttcttccacacccgcttttttaatatctctctctatctcttcatcaccaatttcacca |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31924879 |
ccatctaaatcatcttcttccacacccgcttttttaatatct--ctctatctcttcatcaccaatttcacca |
31924810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 305 - 369
Target Start/End: Original strand, 17469734 - 17469798
Alignment:
| Q |
305 |
attattatcttcatcaattattcatcgctatcttactaatattaacccttggcagtcctattgac |
369 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| ||||| ||||| ||||||||| |||||||||| |
|
|
| T |
17469734 |
attattatcttcatcaatgattcatggctatcatactattattagcccttggcattcctattgac |
17469798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University