View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_high_82 (Length: 299)
Name: NF14349_high_82
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_high_82 |
 | |
|
| [»] scaffold0366 (2 HSPs) |
| | |
|
| [»] scaffold0459 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0366 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 8916 - 8728
Alignment:
| Q |
18 |
gtatgtatgtatttttcaccnnnnnnnttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatg |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8916 |
gtatgtatgtatttttcaccaaaaaaattcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatg |
8817 |
T |
|
| Q |
118 |
cagttgatacggccacagttgccgttgtagagacgtttaaaacctctacactgccgccacaatgcaattgcagaccgtgatttagaact |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8816 |
cagttgatacggccacagttgccgttgtagagacgtttaaaacctctacactgccgccacaatgcaattgcagaccgtgatttagaact |
8728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 294
Target Start/End: Complemental strand, 8677 - 8640
Alignment:
| Q |
257 |
acaggatattggcaccgactatgtatattttctctgct |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8677 |
acaggatattggcaccgactatgtatattttctttgct |
8640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 8992 - 8804
Alignment:
| Q |
18 |
gtatgtatgtatttttcaccnnnnnnnttcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatg |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8992 |
gtatgtatgtatttttcaccaaaaaaattcatgcatgtgtgttcatggtttgaaattgtcagttactttgagaattttaatattgcgacgttggcaaatg |
8893 |
T |
|
| Q |
118 |
cagttgatacggccacagttgccgttgtagagacgtttaaaacctctacactgccgccacaatgcaattgcagaccgtgatttagaact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8892 |
cagttgatacggccacagttgccgttgtagagacatttaaaacctctacactgtcgccacaatgcaattgcagaccgtgatttagaact |
8804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 294
Target Start/End: Complemental strand, 8753 - 8716
Alignment:
| Q |
257 |
acaggatattggcaccgactatgtatattttctctgct |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8753 |
acaggatattggcaccgactatgtatattttctttgct |
8716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University