View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_high_87 (Length: 275)
Name: NF14349_high_87
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_high_87 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 33347390 - 33347127
Alignment:
| Q |
1 |
agaattttgcgggttaaattcatgatgggtatttttgagaacccttttgctgattacagtttggtcaagtatcttgggattaaggttagttattttcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33347390 |
agaattttgcgggttaaattcatgatgggtatttttgagaacccttttgctgattacagtttggtcaagtatcttgggattaaggttagttattttcctt |
33347291 |
T |
|
| Q |
101 |
ttacttccctaagtttacaattagatatcttataaggatcaccctataaatgtctcatctatgcttatttgaattctgaacaggtgcatagagaactggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33347290 |
ttacttccctaagtttacaattagatatcttataaggatcaccctataaatgtctcatctatgcttatttgaattctgaacaggtgcatagagaactggc |
33347191 |
T |
|
| Q |
201 |
tagggatgctgtgaggaaatccatggtccttctnnnnnnntggtaaatctcctgagaagcctttg |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33347190 |
tagggatgctgtgaggaaatccatggtccttct-aaaaaatggtaaatctcctgagaagcctttg |
33347127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 33354431 - 33354167
Alignment:
| Q |
1 |
agaattttgcgggttaaattcatgatgggtatttttgagaacccttttgctgattacagtttggtcaagtatcttgggattaaggttagttattttcctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
33354431 |
agaattttgcgggttaaattcatgatgggtatttttgagaacccatttgccgattacagtttggtcaaatatcttgggattaaggttagctattttcctt |
33354332 |
T |
|
| Q |
101 |
ttacttccctaagtttacaattagatat--cttataaggatcaccctataaatgtctcatctatgcttatttgaattctgaacaggtgcatagagaactg |
198 |
Q |
| |
|
|||| |||||||| || |||||||||| ||||| ||| |||||||||||| |||| ||||||||| ||| |||| |||||||| ||| | ||||||| |
|
|
| T |
33354331 |
ttacatccctaag-ttcgaattagatataacttatctggaccaccctataaatatctcttctatgcttgtttaaattttgaacaggagcacaaagaactg |
33354233 |
T |
|
| Q |
199 |
gctagggatgctgtgaggaaatccatggtccttctnnnnnnntggtaaatctcctgagaagcctttg |
265 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
33354232 |
gctagggaagctgtaaggaaatccatggtccttct-aaaaaatggtaaatctgctgagaagcctttg |
33354167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University