View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_high_92 (Length: 261)
Name: NF14349_high_92
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_high_92 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 28 - 253
Target Start/End: Original strand, 41346790 - 41347015
Alignment:
| Q |
28 |
aaatctttaaaaccaacggtaagatatctaattgagggagttggcatcaaggaacaagatttgggtaaagtcattcaactgagtcctcaaattcttgtcc |
127 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346790 |
aaatctttaaaaccaacggtaagatatttaattgaggaagttggcatcaaggaaaaagatttgggtaaagtcattcaactgagtcctcaaattcttgtcc |
41346889 |
T |
 |
| Q |
128 |
aacgtattgacatttcatggaatactcgattgatgtttcttaacaaagagttggatgcacccaaagagagcattgtgaagatggtgacgaaacaccctca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346890 |
aacgtattgacatttcatggaatactcgattgatgtttcttaacaaagagttggatgcacccaaagagagcattgtgaagatggtgacgaaacaccctca |
41346989 |
T |
 |
| Q |
228 |
gcttctgcattacagtattgatgatg |
253 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
41346990 |
gcttttgcattacagtattgatgatg |
41347015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University