View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_low_108 (Length: 246)
Name: NF14349_low_108
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_low_108 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 35438572 - 35438339
Alignment:
| Q |
11 |
tatgaataacatagctatggctgtgattgccacagccattgcaatatgagctaacattgataaattttggaatgatatgaatcaaatttttgttggagat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35438572 |
tatgaataacatagctatggctgtgattgccacagccattgcaatatgagctaacattgataaattttggaatgatatgaatcaaatttttgttggagat |
35438473 |
T |
|
| Q |
111 |
attcaatgattaaagaaaaaagatactataaaggtggatatgaaaaataacatgtactacaaagtagtataactaatttagtgtatacnnnnnnnnnnaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35438472 |
attcaatgattaaagaaaaaagatactataaaggtggatatgaaaaataacatgtactacaaagtagtataactaatttagtgtatac--ttttttttaa |
35438375 |
T |
|
| Q |
211 |
tgtagtagcaatggttgatgacaatttcaatgaggt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35438374 |
tgtagtagcaatggttgatgacaatttcaatgaggt |
35438339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University