View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14349_low_117 (Length: 231)

Name: NF14349_low_117
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14349_low_117
NF14349_low_117
[»] chr8 (1 HSPs)
chr8 (18-211)||(38936440-38936629)


Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 38936440 - 38936629
Alignment:
18 cgtatgataccaaaactactcatattatgccattttgatttttattacttttgtaaattgaaagaaaattttgttagtgaatagagaaaattgatattaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
38936440 cgtatgataccaaaactactcatattatgccattttgatttttattaattttgtaaattgaaagaaaattttgttagtgaatagagaaaattgatattaa 38936539  T
118 tgtttaggaattctctttttgtttcttgaaggtatatatatgatatgagaaaattggagagttttcagtgtgcagtttctatacggattattat 211  Q
    ||||||||||||||||||||||| ||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38936540 tgtttaggaattctctttttgttacttgaagg----tatatgatatgagaaaattggagagttttcagtgtgcagtttctatacggattattat 38936629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University