View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_low_122 (Length: 223)
Name: NF14349_low_122
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_low_122 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 46175476 - 46175365
Alignment:
| Q |
17 |
tgaagtagacaaagacaagaaaatgaccttagtaggagataccgacccagtacttgtagtggctaagctaaaaaagttatgtcatgcagaaatactttcg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46175476 |
tgaagtagacaaagacaagaaaatgaccttagtaggagataccgacccagtacttatagtggctaagctaagaaagttatgtcatgcagaaatactttcg |
46175377 |
T |
 |
| Q |
117 |
gttggaccaggt |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46175376 |
gttggaccaggt |
46175365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 45043364 - 45043255
Alignment:
| Q |
17 |
tgaagtagacaaagacaagaaaatgaccttagtaggagataccgacccagtacttgtagtggctaagctaaaaaagttatgtcatgcagaaatactttcg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
45043364 |
tgaagtagacaaagacaagaaaatgaccttagtaggagataccgacccagtacttgtagtggctaagctaagaaagttatgtcatgctgaaatactttca |
45043265 |
T |
 |
| Q |
117 |
gttggaccag |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
45043264 |
gttggaccag |
45043255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 27 - 126
Target Start/End: Complemental strand, 45036030 - 45035931
Alignment:
| Q |
27 |
aaagacaagaaaatgaccttagtaggagataccgacccagtacttgtagtggctaagctaaaaaagttatgtcatgcagaaatactttcggttggaccag |
126 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || ||| ||| ||||||||||||| ||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45036030 |
aaagacaagaaaatgaccttaataggagatattgatccaatacgtgtagtggctaagttaaggaagttatgtcatgcagaaatactttcagttggaccag |
45035931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 27 - 126
Target Start/End: Complemental strand, 45041293 - 45041194
Alignment:
| Q |
27 |
aaagacaagaaaatgaccttagtaggagataccgacccagtacttgtagtggctaagctaaaaaagttatgtcatgcagaaatactttcggttggaccag |
126 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || ||||||| ||||||||||||||||| ||| | ||| |||| ||||||||||| |||||||||| |
|
|
| T |
45041293 |
aaagacaagaaaatgaccttaataggagatattgatccagtacgtgtagtggctaagctaaggaagatttgttatgctgaaatactttcagttggaccag |
45041194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University