View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_low_75 (Length: 332)
Name: NF14349_low_75
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_low_75 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 23 - 324
Target Start/End: Original strand, 49094362 - 49094660
Alignment:
| Q |
23 |
atgttctcaagtgtaagaaaaaggtctttgttcctagcctgaatacttcttcattcacaagcaaacttactttagagcagggatttgagattagctagag |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49094362 |
atgttctcaagtgtaagaaaaaggtctttgttcctagcctgaatacttc---attcacaaacaaacttactttagagaagggatttgagattagctagag |
49094458 |
T |
 |
| Q |
123 |
tggtgtggatgatgaagagaaatgtcacgactgtatgaaatctggtggaagatgtggattcaatgtatctgcaaatgaagttatgtgcatctcctctatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49094459 |
tggtgtggatgatgaagagaaatgtcacgactgcatgaaatctggtggaagatgtggattcaatgtatctgcaaatgaagttatgtgcatctcctctatg |
49094558 |
T |
 |
| Q |
223 |
caatctctgataccatcatcacaaggaacaccaacacacaatattccttcttctcccaatatttaattatattcttttgatgaactagtttctagaatta |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49094559 |
caatctctgataccatcatcacaaggaacaccaacacacaatattccttcttctcccgatatataattatattcttttgatgaactagtttctagaatta |
49094658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University