View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_low_76 (Length: 332)
Name: NF14349_low_76
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 155 - 314
Target Start/End: Complemental strand, 1182893 - 1182734
Alignment:
| Q |
155 |
gaagcttcgaaaacgaatcttctagaagtgaatattttggttgaagttttaatggaagcagacataccaagaatttctctcgccggaaagagagtggctg |
254 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1182893 |
gaagcttcgaaaatgaatcttctagaagtgaatattttggttgaagttttaatggaagcagacataccaggaatttctctcgccggaaagagagtggctg |
1182794 |
T |
 |
| Q |
255 |
cagtggttaagtccgggagtgaaaccggttgtgttccgccgcagacgacggtccaagtgg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1182793 |
cagtggttaagtccgggagtgaaaccggttgtgttccgccgcagacgacggtccaagtgg |
1182734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 1183047 - 1182945
Alignment:
| Q |
1 |
ctgcttaaacgacgtcgtttttgaacgagaagatgcagaaagagcacatttccaaatgagagctagaacaacttcaaccctagaaggatgaaactgaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1183047 |
ctgcttaaacgacgtcgtttttgaacgagaagatgctgaaagagcacatttccaaatgagagctagaacaacttcaaccctagaaggatgaaactgaagc |
1182948 |
T |
 |
| Q |
101 |
tcg |
103 |
Q |
| |
|
||| |
|
|
| T |
1182947 |
tcg |
1182945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University