View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_low_88 (Length: 298)
Name: NF14349_low_88
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_low_88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 32214843 - 32214578
Alignment:
| Q |
19 |
gtataggcattgcaggtgtcaactttatctttgctgaaatataagcttttttcagaagtatggcggtgtcaattagcttaaccagggatcaagagcacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
32214843 |
gtataggcattgcaggtgtcaactttatctttgctgaaatataagcttttttcagaagtatggcggtgtcaattagctttactagggatcaagagcacaa |
32214744 |
T |
 |
| Q |
119 |
ctcttttagtcaccattcttctaattacagttaattttcagctcttgataaaaatttccaaggcattgtgtatatatatttcattattttgttgcttcgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32214743 |
ctcttttagtcaccattcttctaattacagttaattttcagctcttgataaaaatttccaaggcattttgtatatatatttcattattttgttgcttcgt |
32214644 |
T |
 |
| Q |
219 |
ttaatctttaacatatttcagttttgtgctttcagttactacttactagtgtgtttaatgaatgat |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32214643 |
ttaatctttaacatatttcagttttgtgctttcagttactacttactagtgtgtttaatgaatgat |
32214578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University