View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14349_low_90 (Length: 295)
Name: NF14349_low_90
Description: NF14349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14349_low_90 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 277
Target Start/End: Complemental strand, 35560872 - 35560611
Alignment:
| Q |
15 |
cataggtgccacattgcagacacgtgacctggctaattatcaagtaagaaaattattctctgannnnnnnnnnnaaagaaaaattattctatgatggtga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||| ||| |
|
|
| T |
35560872 |
cataggtgccacattgcagacacgtgacctggctaattctcaagtaagaaaattattctatgattttttttt--aaagaaaaattattctatgatgatga |
35560775 |
T |
 |
| Q |
115 |
tgatga-tgtttttattttgacaaaattttataatgatgacgatgatccttgcattattaaatttcaaaggccaacctgaaaagaaaaaacaattattct |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35560774 |
tgatgactgtttttattttgacaaaattttataatgatgacgatgatccttgcattattaaatttcaaaggccaacctgaaaagaaaaaacaattattct |
35560675 |
T |
 |
| Q |
214 |
tcaataaaagtctctgatagtaaaatgaagatagggctaagatgttttaaaagtaagatgaatt |
277 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35560674 |
tcaatagaagtctctgatagtaaaatgaagatagggctaagatgttttaaaagtaagatgaatt |
35560611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University