View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14350_low_5 (Length: 234)
Name: NF14350_low_5
Description: NF14350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14350_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 37425807 - 37425589
Alignment:
| Q |
1 |
tggtgctcatgctaatgccatcgttagtactgtttcccgtttcccttctggcttggtgctctaacctctatcccttcaggcttctgttgttgctttttgc |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425807 |
tggtgctcatgctaatgccatctttagtactgtttcccgtttcccttctggcttggtgctctaacctctatcccttcaggcttctgttgttgctttttgc |
37425708 |
T |
 |
| Q |
101 |
tttggtgcagtgatgggctttcttcttgctgcaaatggcatgttggtactatctttgattcccatatcaatcacaaggaccttgtcgcagaaattatccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37425707 |
tttggtgcagtgatgggctttcttcttgctgcaaatggcatgttggtactatctttgattcccatatcaatcacgaggaccttgtcgcagaaattatccg |
37425608 |
T |
 |
| Q |
201 |
actatgaaaccagtaaaat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37425607 |
actatgaaaccagtaaaat |
37425589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 81 - 219
Target Start/End: Complemental strand, 37428226 - 37428088
Alignment:
| Q |
81 |
cttctgttgttgctttttgctttggtgcagtgatgggctttcttcttgctgcaaatggcatgttggtactatctttgattcccatatcaatcacaaggac |
180 |
Q |
| |
|
|||||| |||||||||| ||| ||||||||||| ||||||||||||||||||||||||| |||| | ||||||||||||||||||||||| || |||| |
|
|
| T |
37428226 |
cttctgctgttgcttttcgctctggtgcagtgaagggctttcttcttgctgcaaatggcctgttattgctatctttgattcccatatcaattacctggac |
37428127 |
T |
 |
| Q |
181 |
cttgtcgcagaaattatccgactatgaaaccagtaaaat |
219 |
Q |
| |
|
| | |||| ||||||||||||| ||||||| ||||| |
|
|
| T |
37428126 |
tgtatgacagatattatccgactataaaaccagcaaaat |
37428088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 78 - 136
Target Start/End: Complemental strand, 37433255 - 37433197
Alignment:
| Q |
78 |
aggcttctgttgttgctttttgctttggtgcagtgatgggctttcttcttgctgcaaat |
136 |
Q |
| |
|
||||||| | |||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
37433255 |
aggcttccgctgttgcttttccctctggtgcagtgatgggctttcttcttgctgcaaat |
37433197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University