View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14350_low_7 (Length: 201)
Name: NF14350_low_7
Description: NF14350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14350_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 4643982 - 4643797
Alignment:
| Q |
1 |
acctgaagatggcttgccacattatgccttgtcaaaccgtcgactttcattaattccaaaatacgagaaggaatggcttgatcaatacctagttgttcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4643982 |
acctgaagatggcttgccacattatgccttgtcaaaccgtcgactttcattaactccaatatacgagaaggaatggcttgatcaatacctagttgttcca |
4643883 |
T |
 |
| Q |
101 |
ctgccttcacaaattttttgtgcagctcagctgtccagtctacctgaaccaaaaccaagaaccataagtgtaatcagataatcata |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4643882 |
ctgccttcacaaattttttgtgcagctcagctgtccagtctacctgaaccaaaaccaagaaccataagtgtaatcagataatcata |
4643797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 40801957 - 40802103
Alignment:
| Q |
1 |
acctgaagatggcttgccacattatgccttgtcaaaccgtcgactttcattaattccaaaatacgagaaggaatggcttgatcaatacctagttgttcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || || |||||||||| ||||| || ||||||||||| || |||||||| |||||||| |||| |
|
|
| T |
40801957 |
acctgaagatggcttgccacattatgccttgtcaatccctccactttcattagatccaatattcgagaaggaatagcgtgatcaatgcctagttgctcca |
40802056 |
T |
 |
| Q |
101 |
ctgccttcacaaattttttgtgcagctcagctgtccagtctacctga |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
40802057 |
ctgccttcacaaattttttgtgcagctccggcgtccagtctacctga |
40802103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University