View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14351_high_17 (Length: 255)
Name: NF14351_high_17
Description: NF14351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14351_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 17110275 - 17110506
Alignment:
| Q |
1 |
aaggagacagttgtcaaaggtatcattttcccgtaaaacacatatctataccatccaatcaccttcttctgctttggtaactgcacagagaaagaaaaga |
100 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17110275 |
aaggagacagttgtcaatggtatcatttccccgtaaaacacataactataccatccaatcaccttcttctgctttggtaactgcacagagaaagaaaaga |
17110374 |
T |
 |
| Q |
101 |
gaaatcggtttaagggatcgagggtgccatatcaccgttcgctcatcggaatccggcgaacttcagatcgattttcttgcttctccggtaagtccgttga |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17110375 |
gaaatcggtttaaggggtcgagggtgccatatcaccggtcgctcatcggaatccggcgaacttcagatcgcttttcttgcttctccggtaagtccgttga |
17110474 |
T |
 |
| Q |
201 |
tcattttcacttccttgttctgcagtttccga |
232 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
17110475 |
tcattttcacttccctgttctgcagtttccga |
17110506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 133 - 232
Target Start/End: Complemental strand, 17129108 - 17129009
Alignment:
| Q |
133 |
caccgttcgctcatcggaatccggcgaacttcagatcgattttcttgcttctccggtaagtccgttgatcattttcacttccttgttctgcagtttccga |
232 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
17129108 |
caccgatcgctcatcggattccggcgaacttcagatcgcttttcttgcttctccggtaagtccgttgatcattttcacttcctggatctgcagtttccga |
17129009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University