View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14351_high_21 (Length: 234)
Name: NF14351_high_21
Description: NF14351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14351_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 528391 - 528197
Alignment:
| Q |
18 |
attaagacccttaatctgcactgaggagccaccaacgcttaaaccctcttctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528391 |
attaagacccttaatctgcactgaggagccaccaacgcttaaaccctctcctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatcc |
528292 |
T |
 |
| Q |
118 |
gtagagcgtgaagcaacatgagtgctattgttggatgatgttatattggcacgagagtctgtcggcgtctcgcccacaaacctttcaagctggcg |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528291 |
gtagagtgtgaagcaacatgagtgctattgttggatgatgttatattggcacgagagtctgtcggcgtctcgcccacaaacctttcaagctggcg |
528197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University