View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14351_low_11 (Length: 432)
Name: NF14351_low_11
Description: NF14351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14351_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 155 - 416
Target Start/End: Complemental strand, 43923442 - 43923199
Alignment:
| Q |
155 |
ctcgcacatctatgtcacaaaaacggcaacgaccacgatcaccaccgcaccaccgttgtcctcgctcgaaacgccgtcgtttggaacacggcgcgaagat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43923442 |
ctcgcacatctatgtcacaaaaacggcaacgacca-gatcaccaccgcaccaccgttgtcctcgctcgaaacgccgtcgtttggaacacggcgcgaagat |
43923344 |
T |
 |
| Q |
255 |
ccattgcggcgttcgatcgatctccacattctctctccgcagttcaacaacatttcacattcttccaattttatcgaacccgcattgccattcccccgaa |
354 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43923343 |
ccat-----------------ctccacattctctctccgcagttcaacaacatttcacattcttccaattttatcgaacccgcattgccattcccccgaa |
43923261 |
T |
 |
| Q |
355 |
cattgttccctctgcagcttcaattttcggagccctaattttctcaacaagaagcgtagatt |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43923260 |
cattgttccctctgcagcttcaattttcggagccctaattttctcaacaagaagcgtagatt |
43923199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University