View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14351_low_22 (Length: 267)
Name: NF14351_low_22
Description: NF14351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14351_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 25027183 - 25027357
Alignment:
| Q |
17 |
atattcattattagttttgtcatatgcataagtctaactgtcatataattactcatcacctatagggatcacatggttgaagtagcaacaagctgattca |
116 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25027183 |
atattcattattacttttgtcacatgcataagtctaactgtcatataggt-ctcatcacctatagggatcacatggttgaagtagcaacaagctgattca |
25027281 |
T |
|
| Q |
117 |
ctctttgttttgttcaaaatgaatgagaagtgagaattcagaattcccaaaatgttcaaaactctcaatatgttggc |
193 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25027282 |
c-ctttgttttgttcaaaatgaatgagaagtgagaattcagaattcccaaaatgttcaaaactctcaatatgttggc |
25027357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 185 - 260
Target Start/End: Original strand, 25031889 - 25031964
Alignment:
| Q |
185 |
tatgttggcatggttatcacattatcacttccctccaaaaatacgtactgattggttccagtcccatccctctctg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031889 |
tatgttggcatggttatcacattatcacttccctccaaaaatacgtactgattggttccagtcccatccctctctg |
25031964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University