View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14351_low_25 (Length: 245)
Name: NF14351_low_25
Description: NF14351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14351_low_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 23 - 245
Target Start/End: Complemental strand, 55172603 - 55172381
Alignment:
| Q |
23 |
agctagctggcaaataattaattcatttattgattataatgaatgaacagattgtttcacaacataataaaaggaacttcgtgaagtctgctgtcgcaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55172603 |
agctagctggcaaataattaattcatttattgattataatgaatgaacagattgtttcacaacataataaaaggaacttcgtgaagtctgctgtcgcaaa |
55172504 |
T |
 |
| Q |
123 |
caacctcaaatgggagctgtttcttgaggcaattccatcatctaagaaacttgaatcaaatcaaaaaattccattagagctttacacaatgcttaaagac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55172503 |
caacctcaaatgggagctgtttcttgaggcaattccatcatctaagaaacttgaatcaaatcaaaaaattccattagagctttacacattgcttaaagac |
55172404 |
T |
 |
| Q |
223 |
accacagattatggatggtacac |
245 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
55172403 |
accacagattatggatggtacac |
55172381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University