View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14351_low_28 (Length: 234)

Name: NF14351_low_28
Description: NF14351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14351_low_28
NF14351_low_28
[»] chr5 (1 HSPs)
chr5 (18-212)||(528197-528391)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 528391 - 528197
Alignment:
18 attaagacccttaatctgcactgaggagccaccaacgcttaaaccctcttctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||     
528391 attaagacccttaatctgcactgaggagccaccaacgcttaaaccctctcctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatcc 528292  T
118 gtagagcgtgaagcaacatgagtgctattgttggatgatgttatattggcacgagagtctgtcggcgtctcgcccacaaacctttcaagctggcg 212  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
528291 gtagagtgtgaagcaacatgagtgctattgttggatgatgttatattggcacgagagtctgtcggcgtctcgcccacaaacctttcaagctggcg 528197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University