View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14351_low_30 (Length: 224)
Name: NF14351_low_30
Description: NF14351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14351_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 132
Target Start/End: Original strand, 32647380 - 32647496
Alignment:
| Q |
16 |
agtttaagccttgatgccagtgaaccgagacaagagagcataatacaaatttaaataaatgagtctattgtaagagatgctgaactaggagacaacatgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32647380 |
agtttaagccttgatgccagtgaaccgagacaagagagcataatacaaatttaaataaatgagtctattgtcagagatgctgaactaggagacaacatgt |
32647479 |
T |
 |
| Q |
116 |
aaattcacctagttagc |
132 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32647480 |
aaattcacctagttagc |
32647496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University