View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14352_high_22 (Length: 283)
Name: NF14352_high_22
Description: NF14352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14352_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 43219724 - 43219972
Alignment:
| Q |
13 |
gagaagaatgagaaggagaaaggaaaaacacaatactagggttggatttgtaagctaatatttgcacatttacatattctaatagaattgtcttgtagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219724 |
gagaagaatgagaaggagaaaggaaaaacacaatacaagggttggatttgtaagctaatatttgcacatttacatattctaatagaattgtcttgtagaa |
43219823 |
T |
|
| Q |
113 |
atgtatataattgaattggattgattaaacacgtgggagggttttgtcttggatttggtgagatattaacaataaaaacaaaaataatatgcagatatca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219824 |
atgtatataattgaattggattgattaaacacgtgggagggttttgtcttggatttggtgagatattaacaataaaaacaaaaataatatgcagatatca |
43219923 |
T |
|
| Q |
213 |
tatcatgatcatactcaggtgggtgggtctagcgctacgtgttatgggc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43219924 |
tatcatgatcatactcaggtgggtgggtctagcgctacgtgttatgggc |
43219972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University