View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14352_low_28 (Length: 258)
Name: NF14352_low_28
Description: NF14352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14352_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 10289060 - 10288832
Alignment:
| Q |
19 |
caagggttatacatgattatcacacaaattggattatagtagcctaattgatatagttttgtagatggagtattgcatgaatataggcttttgagtgaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10289060 |
caagggttatacatgattatcacacaaattggattatagtagcctaattgatatagttttgtagatggagtattgcatgaatataggcttttgagtgaca |
10288961 |
T |
 |
| Q |
119 |
ctcctccacatggtctcactcaaaagcataaacatctacattgacttctttaacattacttacatccactttgcattctcaacttcactcacatcgacgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10288960 |
ctcctccacatggtctcactcaaaagcatgaacatctacattgacttctttaacattactcacatccacattgcattctcaacttcactcacatcgacgt |
10288861 |
T |
 |
| Q |
219 |
tattattaatgaattgatctgatttcatc |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
10288860 |
tattattaatgaattgatctaatttcatc |
10288832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 9748492 - 9748575
Alignment:
| Q |
19 |
caagggttatacatgattatcacacaaattggattatagtagcctaattgatatagttttgtagatggagtattgcatgaatat |
102 |
Q |
| |
|
||||||||||| ||||| || |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9748492 |
caagggttatatatgatcattacacaaattggactatagcagcctaattgatatagttttgtagatggagtattgcattaatat |
9748575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 10297509 - 10297463
Alignment:
| Q |
97 |
gaatataggcttttgagtgacactcctccacatggtctcactcaaaa |
143 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10297509 |
gaatataggcttttgagtgacactcatccacatggtctcactcaaaa |
10297463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 205 - 258
Target Start/End: Complemental strand, 10297403 - 10297350
Alignment:
| Q |
205 |
actcacatcgacgttattattaatgaattgatctgatttcatctcactcgacca |
258 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
10297403 |
actcacatccacattattaataatgaattgatctgatatcatctctctcaacca |
10297350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University