View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14352_low_36 (Length: 211)
Name: NF14352_low_36
Description: NF14352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14352_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 21 - 201
Target Start/End: Original strand, 35743970 - 35744150
Alignment:
| Q |
21 |
tgaatggtgcaggtaggggaggagggggtgggggagaagatgaagaaatagacattgatgcttgttgcagatgagaaggtgtttgtgttggtttaggaga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35743970 |
tgaatggtgcaggtaggggaggagggggtgggggagaagatgaagaaatagacattgatgcttgttgtagatgagaaggtgtttgtgttggtttaggaga |
35744069 |
T |
 |
| Q |
121 |
atttggttgaaattgtttaggagatagtggtaactccacttcttccataacttgatcatgtttaaccattttttgatgatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35744070 |
atttggttgaaattgtttaggagatagtggtaactccacttcttccataacttgatcatgtttaaccattttttgatgatg |
35744150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University