View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_high_26 (Length: 435)
Name: NF14353_high_26
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 28 - 426
Target Start/End: Complemental strand, 9222393 - 9221996
Alignment:
| Q |
28 |
tgtgattttgcggttgtgcggttaaagggaatattcgaaagcatcttccaattttaagaggctaatgtggggtctacatgggagttatcttggactgcat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222393 |
tgtgattttgcggttgtgcggttaaagggaatattcgaaagcatcttccaattttaagaggctaatgtggggtctacatgggagttatcttggactgcat |
9222294 |
T |
 |
| Q |
128 |
gcagataagtacgcagatgcgatcctagccgtacgatggtacgatttggatggatatggtttacgcgttagttaatcgtgtttgttttgattttaattat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222293 |
gcagataagtacgcagatgcgatcctagccgtacgatggtacgatttggatggatatggtttacgcgttagttaatcgtgtttgttttgattttaattat |
9222194 |
T |
 |
| Q |
228 |
ggttattggttaaggaaaccatggtcgcgatggtgtggttttgggtttgtctgcttgcaataattgtacttgtatgggattggtgtgatcgtctttcttg |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222193 |
ggttattggttaaggaaaccatggtcgcgatagtgtgg-tttgtgtttgtctgcttgcaataattgtacttgtatgggattggtgtgatcgtctttcttg |
9222095 |
T |
 |
| Q |
328 |
aataggagaannnnnnnnnnnnnnnngaccaaataattattcggattatttcaagttttgaatattaaactaacttatcttgtcaagttcttgtctctg |
426 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9222094 |
aataggagaattttttggatttttttgaccaaataattattcggattatttcaagttttgaatattaaactaacttatcttgtcaagttcttgtctctg |
9221996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University