View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_high_29 (Length: 427)
Name: NF14353_high_29
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 1e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 255 - 419
Target Start/End: Complemental strand, 3472848 - 3472684
Alignment:
| Q |
255 |
gacggttattgagtttagagcgttgattatttgggcctaagcccattaaaaaagagggattggtgtgtgtggggacgggtgcgtgaagtaggttgtgggt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3472848 |
gacggttattgagtttagagcgttgattatttgggcctaagcccattaaaaaagagggatcggtgtgtgtggggacgggtgcgtgaagtaggttgtgggt |
3472749 |
T |
 |
| Q |
355 |
taattatttatgtgagaaagtgaaatggtagactactgggaactcaagttatatttaatctctgc |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3472748 |
taattatttatgtgagaaagtgaaatggtagactactgggaactcaagttatatttaatctctgc |
3472684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 87 - 172
Target Start/End: Complemental strand, 3473035 - 3472955
Alignment:
| Q |
87 |
atattacaaacactgtgaaatgaaatgaaattgaaaatgtttttctccttctttttcactccctcctcagaatctcagattgatga |
172 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3473035 |
atattacaaacactgtgaaatg-----aaattgaaaatgtttttctccttctttttcactccctcctcagaatctcagattgatga |
3472955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University