View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_high_30 (Length: 422)
Name: NF14353_high_30
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 124 - 414
Target Start/End: Complemental strand, 2180129 - 2179844
Alignment:
| Q |
124 |
ctattggctctgagacaagcaatgacaccagaattgttgatttggcagcgtgttttatcaactgtggtggatactgaaagctgaggatgagactctgagg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2180129 |
ctattggctctgagacaagcaatgacaccagaattgttgatttggcagagtgttttatcaactgtggtggatactgaaagctgaggatgagactctgagg |
2180030 |
T |
 |
| Q |
224 |
ctttgcatgtaaccctgctgctaggaagacgcatagaagaagaagttgaagaagacaaccattgacattggttcaaggttaaggttgtacttgcagaggc |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2180029 |
ctttgcatgtaaccctgctgctaggaagacgcatagaa---gaagttgaagaagacaaccattgacattggttcaaggttaaggttgtacttgcagaggc |
2179933 |
T |
 |
| Q |
324 |
cattgtttgttgtaagtgcaaaggttctagttttttctgaaaatacgacatgtgggtttagtggaagatttatcagaggcttatcctttgc |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
2179932 |
cattgtttgttgtaagtgcaaaggttctag--ttttctgaaaatacgacatgtgggtttagtcgaagatttatcaaaggcttatcctttgc |
2179844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 21 - 54
Target Start/End: Complemental strand, 2180233 - 2180200
Alignment:
| Q |
21 |
taagggaccaaattaagttttaagttctacttat |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2180233 |
taagggaccaaattaagttttaagttctacttat |
2180200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University