View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_high_62 (Length: 266)
Name: NF14353_high_62
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_high_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 22 - 243
Target Start/End: Complemental strand, 24180993 - 24180772
Alignment:
| Q |
22 |
gtggtggttgtggctgtaacttggcgtttatgtgtgccgtttgtgaaaggtgaagactttaaggttatgtttggttgtatttgagaatctgcatctatgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24180993 |
gtggtggttgtggctgtaacttggcgtttatgtgtgccgtttgtgaaaggtgaagactttaaggttatgtttggttgtatttgagaatctgcatctatgt |
24180894 |
T |
 |
| Q |
122 |
ttcttgaggttatgtccatgtcttgttgattagggtttgttgaattgtagggttgaaaggggaaagggaacaagaggnnnnnnncaagggaaaaggataa |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24180893 |
ttcttgaggtgatgtccatgtcttgttgattagggtttgttgaattgtagggttgaaaggggaaagggaacaagaggaaaaaaacaagggaaaaggataa |
24180794 |
T |
 |
| Q |
222 |
tggtatgtttggaagagagaat |
243 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
24180793 |
tggtttgtttggaagagagaat |
24180772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University