View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_high_67 (Length: 258)
Name: NF14353_high_67
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_high_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 18427655 - 18427512
Alignment:
| Q |
17 |
atcataggaaaattttgctctaagtttttaacaccttttatgacctttctagaaatgttccttccttaatgcatactatatataatcatctctttaagac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18427655 |
atcataggaaaattttgctctaagtttttaacaccttttatgacttttctagaaatgttccttccttaatgcatactatatataatcatctctttaagac |
18427556 |
T |
 |
| Q |
117 |
cttaagatttatcaagccgcattctcttaccaaaacaagcataa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18427555 |
cttaagatttatcaagccgcattctcttaccaaaacaagcataa |
18427512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 200 - 258
Target Start/End: Complemental strand, 18427472 - 18427414
Alignment:
| Q |
200 |
ccaaataacacctcatttgtagaaaaactataacatttattatatacaatattatggct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18427472 |
ccaaataacacctcatttgtagaaaaactataacatttattttatacaatattatggct |
18427414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University