View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14353_high_79 (Length: 230)

Name: NF14353_high_79
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14353_high_79
NF14353_high_79
[»] chr3 (2 HSPs)
chr3 (155-212)||(48201761-48201818)
chr3 (6-78)||(48201613-48201685)


Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 48201761 - 48201818
Alignment:
155 accttcttcaaacaaactctaaactctactgatgtttttcatctccattattgtgatt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48201761 accttcttcaaacaaactctaaactctactgatgtttttcatctccattattgtgatt 48201818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 6 - 78
Target Start/End: Original strand, 48201613 - 48201685
Alignment:
6 tgtccaagaatatgttttctaggaaaccttataaaaattatctaacaaaatttaagaataaattctttttatt 78  Q
    ||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||    
48201613 tgtccaacaaaatgttttctaggaaaccttataaaaattgtctaacaaaatttaagaataaattatttttatt 48201685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University