View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_high_88 (Length: 201)
Name: NF14353_high_88
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_high_88 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 15635831 - 15635671
Alignment:
| Q |
20 |
ataggtagtagcattggtgactatagagacgttgatgggatcttgattgcacatcaaggtcggtccatcgcgacggtgtttcgattcggtgaactctcga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15635831 |
ataggtagtagcattggtgactatagagacgttgatgggatcttgattgcacatcaaggtcggtccatcgcgacggtgtttcgattcggtgaactctcga |
15635732 |
T |
 |
| Q |
120 |
tgcagcatagtagaaccagaatggaagagatttggaccattgatgatgttatgtttaatgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15635731 |
tgcagcatagtagaaccaggatggaagagatttggaccattgatgatgttatgtttaatgt |
15635671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University