View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_low_49 (Length: 334)
Name: NF14353_low_49
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 13 - 195
Target Start/End: Original strand, 4116707 - 4116889
Alignment:
| Q |
13 |
tgaataattttggttccaacttatgacagacgcacgatatactcgtgatatgtgtctctcatctcttatggtacactttacaacattgaatctcaagtgt |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4116707 |
tgaataattttggttccaacttatcacagacgcacgatatactcgtgatatgtgcatcttatctcttatggtacactttacaacattgaatttcaagtgt |
4116806 |
T |
|
| Q |
113 |
actaaatattacctttcaatagagctgttgagctctttgtttccatcaactacgtcatttagcatgcatattattattaatta |
195 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4116807 |
actaaatatgacctttcaatagagttgttgagctctttgtttccatcaactacgtcatttagcatgcgtattattattaatta |
4116889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 205 - 334
Target Start/End: Original strand, 4119233 - 4119362
Alignment:
| Q |
205 |
gtataatgtttttgggtaatgtttgttcttgtggcaatggagcggggcgaggtggtgatggttcaagagaagacggttgtggtgacattttagtagaagt |
304 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4119233 |
gtataatgtttttgggtaatgtatgttcttgtggcaatggagcggggcgaggtggtgatggttcaagagaagacgtttgtggtgacattttagtagaagt |
4119332 |
T |
|
| Q |
305 |
ctccagtgatgaactttgtggtgacgtttc |
334 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
4119333 |
ctccggtgatgaactttgtggtgacgtttc |
4119362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University