View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_low_57 (Length: 301)
Name: NF14353_low_57
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 11 - 180
Target Start/End: Original strand, 27001715 - 27001884
Alignment:
| Q |
11 |
cacagagcatatgatccattttaacttttttaatggcaatgtgacacgaagtgtcaatatgttccaatccatccaaggtatcatttttattgtataatca |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27001715 |
cacagaggatatgatccattttaacttttttaatggcaatgtgacacgaagtgtcaatatgttccaatcaatccaaggtatcatttttattgtataatca |
27001814 |
T |
 |
| Q |
111 |
agctagggatcaagtttaaaaccattaattaggaagtttaagtgatacaaggtttactttattatgttat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27001815 |
agctagggatcaagtttaaaaccattaattaggaagtttaagtgatacaaggtttactttattatgttat |
27001884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 178 - 285
Target Start/End: Original strand, 27001988 - 27002095
Alignment:
| Q |
178 |
tatgcacttgcagatccttgtaacattgctaagatgctaaaatgattggctttatatatgttgttttgtagctaacgtataaatttcaacaatgtaacca |
277 |
Q |
| |
|
|||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27001988 |
tatgtacttgccgatccttgtagcattgctaagatgctaaaatgattggctttatatatgttgttttgtagctaacgtataaatttcaacaatgtaacca |
27002087 |
T |
 |
| Q |
278 |
atttaatt |
285 |
Q |
| |
|
|||||||| |
|
|
| T |
27002088 |
atttaatt |
27002095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University