View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_low_63 (Length: 281)
Name: NF14353_low_63
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 43504149 - 43503887
Alignment:
| Q |
1 |
aaacttgcttctctcactctcccgtggagtaggtatcaagactaaaccacgtgaattattggtgttatcttccttctctcgtctttaattatttcgggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43504149 |
aaacttgcttctctcactctcccgtggagtaggtatcaagactaaaccacgtgaattattggtgttatcttccttctctcgtctttaattgtttcgggtt |
43504050 |
T |
|
| Q |
101 |
tgcttgttaagttttctggtttgtttggtttattgcattcttgggtcaagtggttttgttgatttcatttcgtagcaattattgtcatatctataacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43504049 |
tgcttgttaagttttctggtttgtttggtttattgcattcttgggtcaagtggttttgttgatttcatttcgtagcaattattgtcatatctataacata |
43503950 |
T |
|
| Q |
201 |
tacttttgaatggtgcaacatctcattaacaatttgaagcttttatttgtatctttatatgca |
263 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
43503949 |
tacttttgaattgtgcaacatctcattaacaatttgaagcctttatttgtttctttatatgca |
43503887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University