View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_low_85 (Length: 235)
Name: NF14353_low_85
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_low_85 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 235
Target Start/End: Original strand, 42973568 - 42973788
Alignment:
| Q |
16 |
ttcttttctaacatgtatatctctcttcctatcgccacgtttccttcttcaaccaatcccattcctcccactcttccctatctccactgttcaaacacgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42973568 |
ttcttttctaacatgtatatctctcttcctatcgccacgtttccttcttcaaccaatcccattcctcccactcttccctatctccactgttcaaacacgt |
42973667 |
T |
 |
| Q |
116 |
gttttttcttacacgtgtccctttctcactttcctataaaacaaaacctaccctcgtgtccatcacttcatatagttcattgtctctatgcattaatatt |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42973668 |
gttttttcttacacgtgtacctttctcactttcctataaaacaaaacctaccctcgtgtccatcacttcatatagttcatcgtctctatgcattaatatt |
42973767 |
T |
 |
| Q |
216 |
-ctctccttcttttacattac |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42973768 |
cctctccttcttttacattac |
42973788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University