View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14353_low_86 (Length: 230)
Name: NF14353_low_86
Description: NF14353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14353_low_86 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 48201761 - 48201818
Alignment:
| Q |
155 |
accttcttcaaacaaactctaaactctactgatgtttttcatctccattattgtgatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48201761 |
accttcttcaaacaaactctaaactctactgatgtttttcatctccattattgtgatt |
48201818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 6 - 78
Target Start/End: Original strand, 48201613 - 48201685
Alignment:
| Q |
6 |
tgtccaagaatatgttttctaggaaaccttataaaaattatctaacaaaatttaagaataaattctttttatt |
78 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
48201613 |
tgtccaacaaaatgttttctaggaaaccttataaaaattgtctaacaaaatttaagaataaattatttttatt |
48201685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University